Review



hh14000000 microlab star liquid handling system hamilton  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher hh14000000 microlab star liquid handling system hamilton
    Hh14000000 Microlab Star Liquid Handling System Hamilton, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hh14000000+microlab+star+liquid+handling+system+hamilton/HH14000000+Microlab+STAR+Liquid+Handling+System+Hamilton/pm34520744-472-104-142
    Average 90 stars, based on 1 article reviews
    hh14000000 microlab star liquid handling system hamilton - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Negative Control:

    Article Title: Targeting non-canonical pathways as a strategy to modulate the sodium iodide symporter.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 TaqMan Gene Expression Master Mix Applied Biosystems Cat# 10525395 Nano-Glo Live Cell Assay Solution Promega Cat# N2011 NIS TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs00166567_m1 PPIA TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs04194521_s1 VCP TaqMan Gene Expression Assay ThermoFisher Scientific Cat# HS00997642_m1 Deposited data The Connectivity Map (CMAP) Subramanian et al., 2017 https://clue.io/touchstone Data source file This paper Mendeley Data: https://doi.org/10.17632/ vf3xnyxyp9.1 GSE27155 Giordano et al., 2005 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE27155 GSE76039 Landa et al., 2016 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE76039 TCGA GDAC Firehose standard data – Thyroid Carcinoma (THCA) Broad Institute of MIT and Harvard Firehose stddata__2016_01_28 run. https:// doi.org/10.7908/C11G0KM9 TCGA THCA Grossman et al., 2016 https://portal.gdc.cancer.gov/projects/ TCGA-THCA Thyroid carcinoma (TCGA, Firehose Legacy) Cerami et al., 2012; Gao et al., 2013 https://www.cbioportal.org/study/ summary?id=thca_tcga Experimental Models: Cell Lines TPC-1 Rebecca Schweppe’s lab N/A TPC-1-YFP This paper N/A TPC-1-NIS-YFP This paper N/A 8505C DSMZ Cat# ACC-219, RRID:CVCL_1054 8505C-YFP This paper N/A 8505C-NIS-YFP This paper N/A MDA-MB-231 ECACC Cat# 92020424, RRID:CVCL_0062 MCF7 ECACC Cat# 86012803, RRID:CVCL_0031 MDA-MB-231-NIS Fletcher et al., 2020 N/A HeLa ECACC Cat# 93021013, RRID:CVCL_0030 Oligonucleotides MISSION VCP siRNA Sigma-Aldrich Cat# NM_007126 LgBiT (Forward)5’-GCCAAGCTTAC CATGGTCTTCACACTCGAA-3’ Sigma-Aldrich Custom synthesis LgBiT (Reverse)5’-GGCGGTACCAC TGTTGATGGTTA CTCG-3’ Sigma-Aldrich Custom synthesis VCP (Forward)5’-GCGGTACCGCTT CTGGAGCCGATTCA-3’ Sigma-Aldrich Custom synthesis VCP (Reverse)5’-GCCGCCTCTAG ATTAGCCATACAGGTCATC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Forward)5’-GCCGGTACC ACCATGGAGGCCGTGGAGACC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Reverse)5’-GCCTCTAGA TTACAGAATCTCCTCGAACAGCCGG TAGCCGGTCACGAGGTTTGTCTCC TGCTG-3’ Sigma-Aldrich Custom synthesis Recombinant DNA pcDNA3.1-EYFP-H148Q/I152L/F46L Alan Verkman’s lab N/A pcDNA3.1-NIS Smith et al., 2009 N/A (Continued on next page) e2 Cell Chemical Biology 29, 502–516.e1–e7, March 17, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Halo-tagSmBiT (negative control) Caroline Gorvin’s lab N/A LgBiT-PRKAR2A (positive control) Caroline Gorvin’s lab N/A SmBiT-PRKACA (positive control) Caroline Gorvin’s lab N/A pcDNA3.1-LgBiT-VCP This paper N/A pcDNA3.1-NIS-SmBiT This paper N/A Software and Algorithms GraphPad Prism Version 9 Graphpad Software Inc https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.nih.gov/ij/ IBM SPSS Statistics Version 27 IBM https://www.ibm.com/uk-en/products/ spss-statistics BioRender BioRender https://biorender.com/ EC50 Calculator AAT Bioquest https://www.aatbio.com/tools/ec50- calculator GEO2R National Center for Biotechnology Information https://www.ncbi.nlm.nih.gov/geo/geo2r/ DynaVenn Chair for Clinical Bioinformatics at Saarland University https://ccb-compute.cs.uni-saarland.de/ dynavenn Other Prestwick Chemical Library Birmingham Drug Discovery Facility https://www.birmingham.ac.uk/facilities/ bddf/compound-collections/index.aspx Opera Phenix High-Content Screening System Perkin Elmer Cat# HH14000000 Microlab STAR Liquid Handling System Hamilton https://www.hamiltoncompany.com/ automated-liquid-handling/platforms/ microlab-star PHERAstar FS microplate reader BMG Labtech https://www.bmglabtech.com/ pherastar-fsx/ POLARstar Omega microplate reader BMG Labtech https://www.bmglabtech.com/ polarstar-omega/ Multi Crystal LB 2111 Gamma Counter Berthold https://www.berthold.com/en/ 7500 Real-Time PCR system ThermoFisher Scientific Cat# 4351105 ..

    Positive Control:

    Article Title: Targeting non-canonical pathways as a strategy to modulate the sodium iodide symporter.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 TaqMan Gene Expression Master Mix Applied Biosystems Cat# 10525395 Nano-Glo Live Cell Assay Solution Promega Cat# N2011 NIS TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs00166567_m1 PPIA TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs04194521_s1 VCP TaqMan Gene Expression Assay ThermoFisher Scientific Cat# HS00997642_m1 Deposited data The Connectivity Map (CMAP) Subramanian et al., 2017 https://clue.io/touchstone Data source file This paper Mendeley Data: https://doi.org/10.17632/ vf3xnyxyp9.1 GSE27155 Giordano et al., 2005 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE27155 GSE76039 Landa et al., 2016 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE76039 TCGA GDAC Firehose standard data – Thyroid Carcinoma (THCA) Broad Institute of MIT and Harvard Firehose stddata__2016_01_28 run. https:// doi.org/10.7908/C11G0KM9 TCGA THCA Grossman et al., 2016 https://portal.gdc.cancer.gov/projects/ TCGA-THCA Thyroid carcinoma (TCGA, Firehose Legacy) Cerami et al., 2012; Gao et al., 2013 https://www.cbioportal.org/study/ summary?id=thca_tcga Experimental Models: Cell Lines TPC-1 Rebecca Schweppe’s lab N/A TPC-1-YFP This paper N/A TPC-1-NIS-YFP This paper N/A 8505C DSMZ Cat# ACC-219, RRID:CVCL_1054 8505C-YFP This paper N/A 8505C-NIS-YFP This paper N/A MDA-MB-231 ECACC Cat# 92020424, RRID:CVCL_0062 MCF7 ECACC Cat# 86012803, RRID:CVCL_0031 MDA-MB-231-NIS Fletcher et al., 2020 N/A HeLa ECACC Cat# 93021013, RRID:CVCL_0030 Oligonucleotides MISSION VCP siRNA Sigma-Aldrich Cat# NM_007126 LgBiT (Forward)5’-GCCAAGCTTAC CATGGTCTTCACACTCGAA-3’ Sigma-Aldrich Custom synthesis LgBiT (Reverse)5’-GGCGGTACCAC TGTTGATGGTTA CTCG-3’ Sigma-Aldrich Custom synthesis VCP (Forward)5’-GCGGTACCGCTT CTGGAGCCGATTCA-3’ Sigma-Aldrich Custom synthesis VCP (Reverse)5’-GCCGCCTCTAG ATTAGCCATACAGGTCATC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Forward)5’-GCCGGTACC ACCATGGAGGCCGTGGAGACC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Reverse)5’-GCCTCTAGA TTACAGAATCTCCTCGAACAGCCGG TAGCCGGTCACGAGGTTTGTCTCC TGCTG-3’ Sigma-Aldrich Custom synthesis Recombinant DNA pcDNA3.1-EYFP-H148Q/I152L/F46L Alan Verkman’s lab N/A pcDNA3.1-NIS Smith et al., 2009 N/A (Continued on next page) e2 Cell Chemical Biology 29, 502–516.e1–e7, March 17, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Halo-tagSmBiT (negative control) Caroline Gorvin’s lab N/A LgBiT-PRKAR2A (positive control) Caroline Gorvin’s lab N/A SmBiT-PRKACA (positive control) Caroline Gorvin’s lab N/A pcDNA3.1-LgBiT-VCP This paper N/A pcDNA3.1-NIS-SmBiT This paper N/A Software and Algorithms GraphPad Prism Version 9 Graphpad Software Inc https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.nih.gov/ij/ IBM SPSS Statistics Version 27 IBM https://www.ibm.com/uk-en/products/ spss-statistics BioRender BioRender https://biorender.com/ EC50 Calculator AAT Bioquest https://www.aatbio.com/tools/ec50- calculator GEO2R National Center for Biotechnology Information https://www.ncbi.nlm.nih.gov/geo/geo2r/ DynaVenn Chair for Clinical Bioinformatics at Saarland University https://ccb-compute.cs.uni-saarland.de/ dynavenn Other Prestwick Chemical Library Birmingham Drug Discovery Facility https://www.birmingham.ac.uk/facilities/ bddf/compound-collections/index.aspx Opera Phenix High-Content Screening System Perkin Elmer Cat# HH14000000 Microlab STAR Liquid Handling System Hamilton https://www.hamiltoncompany.com/ automated-liquid-handling/platforms/ microlab-star PHERAstar FS microplate reader BMG Labtech https://www.bmglabtech.com/ pherastar-fsx/ POLARstar Omega microplate reader BMG Labtech https://www.bmglabtech.com/ polarstar-omega/ Multi Crystal LB 2111 Gamma Counter Berthold https://www.berthold.com/en/ 7500 Real-Time PCR system ThermoFisher Scientific Cat# 4351105 ..

    Software:

    Article Title: Targeting non-canonical pathways as a strategy to modulate the sodium iodide symporter.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 TaqMan Gene Expression Master Mix Applied Biosystems Cat# 10525395 Nano-Glo Live Cell Assay Solution Promega Cat# N2011 NIS TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs00166567_m1 PPIA TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs04194521_s1 VCP TaqMan Gene Expression Assay ThermoFisher Scientific Cat# HS00997642_m1 Deposited data The Connectivity Map (CMAP) Subramanian et al., 2017 https://clue.io/touchstone Data source file This paper Mendeley Data: https://doi.org/10.17632/ vf3xnyxyp9.1 GSE27155 Giordano et al., 2005 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE27155 GSE76039 Landa et al., 2016 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE76039 TCGA GDAC Firehose standard data – Thyroid Carcinoma (THCA) Broad Institute of MIT and Harvard Firehose stddata__2016_01_28 run. https:// doi.org/10.7908/C11G0KM9 TCGA THCA Grossman et al., 2016 https://portal.gdc.cancer.gov/projects/ TCGA-THCA Thyroid carcinoma (TCGA, Firehose Legacy) Cerami et al., 2012; Gao et al., 2013 https://www.cbioportal.org/study/ summary?id=thca_tcga Experimental Models: Cell Lines TPC-1 Rebecca Schweppe’s lab N/A TPC-1-YFP This paper N/A TPC-1-NIS-YFP This paper N/A 8505C DSMZ Cat# ACC-219, RRID:CVCL_1054 8505C-YFP This paper N/A 8505C-NIS-YFP This paper N/A MDA-MB-231 ECACC Cat# 92020424, RRID:CVCL_0062 MCF7 ECACC Cat# 86012803, RRID:CVCL_0031 MDA-MB-231-NIS Fletcher et al., 2020 N/A HeLa ECACC Cat# 93021013, RRID:CVCL_0030 Oligonucleotides MISSION VCP siRNA Sigma-Aldrich Cat# NM_007126 LgBiT (Forward)5’-GCCAAGCTTAC CATGGTCTTCACACTCGAA-3’ Sigma-Aldrich Custom synthesis LgBiT (Reverse)5’-GGCGGTACCAC TGTTGATGGTTA CTCG-3’ Sigma-Aldrich Custom synthesis VCP (Forward)5’-GCGGTACCGCTT CTGGAGCCGATTCA-3’ Sigma-Aldrich Custom synthesis VCP (Reverse)5’-GCCGCCTCTAG ATTAGCCATACAGGTCATC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Forward)5’-GCCGGTACC ACCATGGAGGCCGTGGAGACC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Reverse)5’-GCCTCTAGA TTACAGAATCTCCTCGAACAGCCGG TAGCCGGTCACGAGGTTTGTCTCC TGCTG-3’ Sigma-Aldrich Custom synthesis Recombinant DNA pcDNA3.1-EYFP-H148Q/I152L/F46L Alan Verkman’s lab N/A pcDNA3.1-NIS Smith et al., 2009 N/A (Continued on next page) e2 Cell Chemical Biology 29, 502–516.e1–e7, March 17, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Halo-tagSmBiT (negative control) Caroline Gorvin’s lab N/A LgBiT-PRKAR2A (positive control) Caroline Gorvin’s lab N/A SmBiT-PRKACA (positive control) Caroline Gorvin’s lab N/A pcDNA3.1-LgBiT-VCP This paper N/A pcDNA3.1-NIS-SmBiT This paper N/A Software and Algorithms GraphPad Prism Version 9 Graphpad Software Inc https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.nih.gov/ij/ IBM SPSS Statistics Version 27 IBM https://www.ibm.com/uk-en/products/ spss-statistics BioRender BioRender https://biorender.com/ EC50 Calculator AAT Bioquest https://www.aatbio.com/tools/ec50- calculator GEO2R National Center for Biotechnology Information https://www.ncbi.nlm.nih.gov/geo/geo2r/ DynaVenn Chair for Clinical Bioinformatics at Saarland University https://ccb-compute.cs.uni-saarland.de/ dynavenn Other Prestwick Chemical Library Birmingham Drug Discovery Facility https://www.birmingham.ac.uk/facilities/ bddf/compound-collections/index.aspx Opera Phenix High-Content Screening System Perkin Elmer Cat# HH14000000 Microlab STAR Liquid Handling System Hamilton https://www.hamiltoncompany.com/ automated-liquid-handling/platforms/ microlab-star PHERAstar FS microplate reader BMG Labtech https://www.bmglabtech.com/ pherastar-fsx/ POLARstar Omega microplate reader BMG Labtech https://www.bmglabtech.com/ polarstar-omega/ Multi Crystal LB 2111 Gamma Counter Berthold https://www.berthold.com/en/ 7500 Real-Time PCR system ThermoFisher Scientific Cat# 4351105 ..

    Drug discovery:

    Article Title: Targeting non-canonical pathways as a strategy to modulate the sodium iodide symporter.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 TaqMan Gene Expression Master Mix Applied Biosystems Cat# 10525395 Nano-Glo Live Cell Assay Solution Promega Cat# N2011 NIS TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs00166567_m1 PPIA TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs04194521_s1 VCP TaqMan Gene Expression Assay ThermoFisher Scientific Cat# HS00997642_m1 Deposited data The Connectivity Map (CMAP) Subramanian et al., 2017 https://clue.io/touchstone Data source file This paper Mendeley Data: https://doi.org/10.17632/ vf3xnyxyp9.1 GSE27155 Giordano et al., 2005 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE27155 GSE76039 Landa et al., 2016 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE76039 TCGA GDAC Firehose standard data – Thyroid Carcinoma (THCA) Broad Institute of MIT and Harvard Firehose stddata__2016_01_28 run. https:// doi.org/10.7908/C11G0KM9 TCGA THCA Grossman et al., 2016 https://portal.gdc.cancer.gov/projects/ TCGA-THCA Thyroid carcinoma (TCGA, Firehose Legacy) Cerami et al., 2012; Gao et al., 2013 https://www.cbioportal.org/study/ summary?id=thca_tcga Experimental Models: Cell Lines TPC-1 Rebecca Schweppe’s lab N/A TPC-1-YFP This paper N/A TPC-1-NIS-YFP This paper N/A 8505C DSMZ Cat# ACC-219, RRID:CVCL_1054 8505C-YFP This paper N/A 8505C-NIS-YFP This paper N/A MDA-MB-231 ECACC Cat# 92020424, RRID:CVCL_0062 MCF7 ECACC Cat# 86012803, RRID:CVCL_0031 MDA-MB-231-NIS Fletcher et al., 2020 N/A HeLa ECACC Cat# 93021013, RRID:CVCL_0030 Oligonucleotides MISSION VCP siRNA Sigma-Aldrich Cat# NM_007126 LgBiT (Forward)5’-GCCAAGCTTAC CATGGTCTTCACACTCGAA-3’ Sigma-Aldrich Custom synthesis LgBiT (Reverse)5’-GGCGGTACCAC TGTTGATGGTTA CTCG-3’ Sigma-Aldrich Custom synthesis VCP (Forward)5’-GCGGTACCGCTT CTGGAGCCGATTCA-3’ Sigma-Aldrich Custom synthesis VCP (Reverse)5’-GCCGCCTCTAG ATTAGCCATACAGGTCATC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Forward)5’-GCCGGTACC ACCATGGAGGCCGTGGAGACC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Reverse)5’-GCCTCTAGA TTACAGAATCTCCTCGAACAGCCGG TAGCCGGTCACGAGGTTTGTCTCC TGCTG-3’ Sigma-Aldrich Custom synthesis Recombinant DNA pcDNA3.1-EYFP-H148Q/I152L/F46L Alan Verkman’s lab N/A pcDNA3.1-NIS Smith et al., 2009 N/A (Continued on next page) e2 Cell Chemical Biology 29, 502–516.e1–e7, March 17, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Halo-tagSmBiT (negative control) Caroline Gorvin’s lab N/A LgBiT-PRKAR2A (positive control) Caroline Gorvin’s lab N/A SmBiT-PRKACA (positive control) Caroline Gorvin’s lab N/A pcDNA3.1-LgBiT-VCP This paper N/A pcDNA3.1-NIS-SmBiT This paper N/A Software and Algorithms GraphPad Prism Version 9 Graphpad Software Inc https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.nih.gov/ij/ IBM SPSS Statistics Version 27 IBM https://www.ibm.com/uk-en/products/ spss-statistics BioRender BioRender https://biorender.com/ EC50 Calculator AAT Bioquest https://www.aatbio.com/tools/ec50- calculator GEO2R National Center for Biotechnology Information https://www.ncbi.nlm.nih.gov/geo/geo2r/ DynaVenn Chair for Clinical Bioinformatics at Saarland University https://ccb-compute.cs.uni-saarland.de/ dynavenn Other Prestwick Chemical Library Birmingham Drug Discovery Facility https://www.birmingham.ac.uk/facilities/ bddf/compound-collections/index.aspx Opera Phenix High-Content Screening System Perkin Elmer Cat# HH14000000 Microlab STAR Liquid Handling System Hamilton https://www.hamiltoncompany.com/ automated-liquid-handling/platforms/ microlab-star PHERAstar FS microplate reader BMG Labtech https://www.bmglabtech.com/ pherastar-fsx/ POLARstar Omega microplate reader BMG Labtech https://www.bmglabtech.com/ polarstar-omega/ Multi Crystal LB 2111 Gamma Counter Berthold https://www.berthold.com/en/ 7500 Real-Time PCR system ThermoFisher Scientific Cat# 4351105 ..

    High Content Screening:

    Article Title: Targeting non-canonical pathways as a strategy to modulate the sodium iodide symporter.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 TaqMan Gene Expression Master Mix Applied Biosystems Cat# 10525395 Nano-Glo Live Cell Assay Solution Promega Cat# N2011 NIS TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs00166567_m1 PPIA TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs04194521_s1 VCP TaqMan Gene Expression Assay ThermoFisher Scientific Cat# HS00997642_m1 Deposited data The Connectivity Map (CMAP) Subramanian et al., 2017 https://clue.io/touchstone Data source file This paper Mendeley Data: https://doi.org/10.17632/ vf3xnyxyp9.1 GSE27155 Giordano et al., 2005 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE27155 GSE76039 Landa et al., 2016 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE76039 TCGA GDAC Firehose standard data – Thyroid Carcinoma (THCA) Broad Institute of MIT and Harvard Firehose stddata__2016_01_28 run. https:// doi.org/10.7908/C11G0KM9 TCGA THCA Grossman et al., 2016 https://portal.gdc.cancer.gov/projects/ TCGA-THCA Thyroid carcinoma (TCGA, Firehose Legacy) Cerami et al., 2012; Gao et al., 2013 https://www.cbioportal.org/study/ summary?id=thca_tcga Experimental Models: Cell Lines TPC-1 Rebecca Schweppe’s lab N/A TPC-1-YFP This paper N/A TPC-1-NIS-YFP This paper N/A 8505C DSMZ Cat# ACC-219, RRID:CVCL_1054 8505C-YFP This paper N/A 8505C-NIS-YFP This paper N/A MDA-MB-231 ECACC Cat# 92020424, RRID:CVCL_0062 MCF7 ECACC Cat# 86012803, RRID:CVCL_0031 MDA-MB-231-NIS Fletcher et al., 2020 N/A HeLa ECACC Cat# 93021013, RRID:CVCL_0030 Oligonucleotides MISSION VCP siRNA Sigma-Aldrich Cat# NM_007126 LgBiT (Forward)5’-GCCAAGCTTAC CATGGTCTTCACACTCGAA-3’ Sigma-Aldrich Custom synthesis LgBiT (Reverse)5’-GGCGGTACCAC TGTTGATGGTTA CTCG-3’ Sigma-Aldrich Custom synthesis VCP (Forward)5’-GCGGTACCGCTT CTGGAGCCGATTCA-3’ Sigma-Aldrich Custom synthesis VCP (Reverse)5’-GCCGCCTCTAG ATTAGCCATACAGGTCATC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Forward)5’-GCCGGTACC ACCATGGAGGCCGTGGAGACC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Reverse)5’-GCCTCTAGA TTACAGAATCTCCTCGAACAGCCGG TAGCCGGTCACGAGGTTTGTCTCC TGCTG-3’ Sigma-Aldrich Custom synthesis Recombinant DNA pcDNA3.1-EYFP-H148Q/I152L/F46L Alan Verkman’s lab N/A pcDNA3.1-NIS Smith et al., 2009 N/A (Continued on next page) e2 Cell Chemical Biology 29, 502–516.e1–e7, March 17, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Halo-tagSmBiT (negative control) Caroline Gorvin’s lab N/A LgBiT-PRKAR2A (positive control) Caroline Gorvin’s lab N/A SmBiT-PRKACA (positive control) Caroline Gorvin’s lab N/A pcDNA3.1-LgBiT-VCP This paper N/A pcDNA3.1-NIS-SmBiT This paper N/A Software and Algorithms GraphPad Prism Version 9 Graphpad Software Inc https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.nih.gov/ij/ IBM SPSS Statistics Version 27 IBM https://www.ibm.com/uk-en/products/ spss-statistics BioRender BioRender https://biorender.com/ EC50 Calculator AAT Bioquest https://www.aatbio.com/tools/ec50- calculator GEO2R National Center for Biotechnology Information https://www.ncbi.nlm.nih.gov/geo/geo2r/ DynaVenn Chair for Clinical Bioinformatics at Saarland University https://ccb-compute.cs.uni-saarland.de/ dynavenn Other Prestwick Chemical Library Birmingham Drug Discovery Facility https://www.birmingham.ac.uk/facilities/ bddf/compound-collections/index.aspx Opera Phenix High-Content Screening System Perkin Elmer Cat# HH14000000 Microlab STAR Liquid Handling System Hamilton https://www.hamiltoncompany.com/ automated-liquid-handling/platforms/ microlab-star PHERAstar FS microplate reader BMG Labtech https://www.bmglabtech.com/ pherastar-fsx/ POLARstar Omega microplate reader BMG Labtech https://www.bmglabtech.com/ polarstar-omega/ Multi Crystal LB 2111 Gamma Counter Berthold https://www.berthold.com/en/ 7500 Real-Time PCR system ThermoFisher Scientific Cat# 4351105 ..

    Real-time Polymerase Chain Reaction:

    Article Title: Targeting non-canonical pathways as a strategy to modulate the sodium iodide symporter.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 TaqMan Gene Expression Master Mix Applied Biosystems Cat# 10525395 Nano-Glo Live Cell Assay Solution Promega Cat# N2011 NIS TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs00166567_m1 PPIA TaqMan Gene Expression Assay ThermoFisher Scientific Cat# Hs04194521_s1 VCP TaqMan Gene Expression Assay ThermoFisher Scientific Cat# HS00997642_m1 Deposited data The Connectivity Map (CMAP) Subramanian et al., 2017 https://clue.io/touchstone Data source file This paper Mendeley Data: https://doi.org/10.17632/ vf3xnyxyp9.1 GSE27155 Giordano et al., 2005 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE27155 GSE76039 Landa et al., 2016 https://www.ncbi.nlm.nih.gov/geo/geo2r/? acc=GSE76039 TCGA GDAC Firehose standard data – Thyroid Carcinoma (THCA) Broad Institute of MIT and Harvard Firehose stddata__2016_01_28 run. https:// doi.org/10.7908/C11G0KM9 TCGA THCA Grossman et al., 2016 https://portal.gdc.cancer.gov/projects/ TCGA-THCA Thyroid carcinoma (TCGA, Firehose Legacy) Cerami et al., 2012; Gao et al., 2013 https://www.cbioportal.org/study/ summary?id=thca_tcga Experimental Models: Cell Lines TPC-1 Rebecca Schweppe’s lab N/A TPC-1-YFP This paper N/A TPC-1-NIS-YFP This paper N/A 8505C DSMZ Cat# ACC-219, RRID:CVCL_1054 8505C-YFP This paper N/A 8505C-NIS-YFP This paper N/A MDA-MB-231 ECACC Cat# 92020424, RRID:CVCL_0062 MCF7 ECACC Cat# 86012803, RRID:CVCL_0031 MDA-MB-231-NIS Fletcher et al., 2020 N/A HeLa ECACC Cat# 93021013, RRID:CVCL_0030 Oligonucleotides MISSION VCP siRNA Sigma-Aldrich Cat# NM_007126 LgBiT (Forward)5’-GCCAAGCTTAC CATGGTCTTCACACTCGAA-3’ Sigma-Aldrich Custom synthesis LgBiT (Reverse)5’-GGCGGTACCAC TGTTGATGGTTA CTCG-3’ Sigma-Aldrich Custom synthesis VCP (Forward)5’-GCGGTACCGCTT CTGGAGCCGATTCA-3’ Sigma-Aldrich Custom synthesis VCP (Reverse)5’-GCCGCCTCTAG ATTAGCCATACAGGTCATC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Forward)5’-GCCGGTACC ACCATGGAGGCCGTGGAGACC-3’ Sigma-Aldrich Custom synthesis NIS-SmBiT (Reverse)5’-GCCTCTAGA TTACAGAATCTCCTCGAACAGCCGG TAGCCGGTCACGAGGTTTGTCTCC TGCTG-3’ Sigma-Aldrich Custom synthesis Recombinant DNA pcDNA3.1-EYFP-H148Q/I152L/F46L Alan Verkman’s lab N/A pcDNA3.1-NIS Smith et al., 2009 N/A (Continued on next page) e2 Cell Chemical Biology 29, 502–516.e1–e7, March 17, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Halo-tagSmBiT (negative control) Caroline Gorvin’s lab N/A LgBiT-PRKAR2A (positive control) Caroline Gorvin’s lab N/A SmBiT-PRKACA (positive control) Caroline Gorvin’s lab N/A pcDNA3.1-LgBiT-VCP This paper N/A pcDNA3.1-NIS-SmBiT This paper N/A Software and Algorithms GraphPad Prism Version 9 Graphpad Software Inc https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.nih.gov/ij/ IBM SPSS Statistics Version 27 IBM https://www.ibm.com/uk-en/products/ spss-statistics BioRender BioRender https://biorender.com/ EC50 Calculator AAT Bioquest https://www.aatbio.com/tools/ec50- calculator GEO2R National Center for Biotechnology Information https://www.ncbi.nlm.nih.gov/geo/geo2r/ DynaVenn Chair for Clinical Bioinformatics at Saarland University https://ccb-compute.cs.uni-saarland.de/ dynavenn Other Prestwick Chemical Library Birmingham Drug Discovery Facility https://www.birmingham.ac.uk/facilities/ bddf/compound-collections/index.aspx Opera Phenix High-Content Screening System Perkin Elmer Cat# HH14000000 Microlab STAR Liquid Handling System Hamilton https://www.hamiltoncompany.com/ automated-liquid-handling/platforms/ microlab-star PHERAstar FS microplate reader BMG Labtech https://www.bmglabtech.com/ pherastar-fsx/ POLARstar Omega microplate reader BMG Labtech https://www.bmglabtech.com/ polarstar-omega/ Multi Crystal LB 2111 Gamma Counter Berthold https://www.berthold.com/en/ 7500 Real-Time PCR system ThermoFisher Scientific Cat# 4351105 ..



    Similar Products

    90
    Thermo Fisher hh14000000 microlab star liquid handling system hamilton
    Hh14000000 Microlab Star Liquid Handling System Hamilton, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hh14000000+microlab+star+liquid+handling+system+hamilton/HH14000000+Microlab+STAR+Liquid+Handling+System+Hamilton/pm34520744-472-104-142
    Average 90 stars, based on 1 article reviews
    hh14000000 microlab star liquid handling system hamilton - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results